TACGEN
Phone: (877) 369-5430
(510) 334-9669
Email: info@tacgen.com

Universal Primers

We provide free universal primers for DNA sequencing.

Primers

Sequences

M13 Forward (-20)

5'd[GTAAAACGACGGCCAG]3' (16-mer)

M13 Forward (-40)

5'd[GTTTTCCCAGTCACGAC]3' (17-mer)

M13 Reverse

5'd[CAGGAAACAGCTATGAC]3' (17-mer)

SP6 Promoter

5'd[GATTTAGGTGACACTATAG]3' (19-mer)

T3 Promoter

5'd[ATTAACCCTCACTAAAGGGA]3' (20-mer)

T7 Promoter

5'd[TAATACGACTCACTATAGGG]3' (20-mer)

T7 Reverse

5'd[TAGTTATTGCTCAGCGGTGG]3' (20-mer)

T7 Terminator

5'd[GCTAGTTATTGCTCAGCGG]3' (19-mer)

AttL1

5'd[TCGCGTTAACGCTAGCATGGATCTC]3' (25-mer)

AttL2

5'd[GTAACATCAGAGATTTTGAGACAC]3' (24-mer)

5AOX

5'd[GACTGGTTCCAATTGACAA]3' (19-mer)

3AOX

5'd[GCAAATGGCATTCTGACATCC]3' (21-mer)

Bac Forward

5'd[TTTTACTGTTTTCGTAACAGTTTT]3' (24-mer)

Bac Reverse

5'd[CGGATTTCCTTGAAGAGAGTA]3' (21-mer)

BGH Reverse

5'd[TAGAAGGCACAGTCGAGG]3' (18-mer)

CMV Forward

5'd[CGCAAATGGGCGGTAGGCGTG]3' (21-mer)

EGFP-C

5'd[CATGGTCCTGCTGGAGTTCGTG]3' (21-mer)

EGFP-N

5'd[CGTCGCCGTCCAGCTCGACCAG]3' (22-mer)

pBAD Forward

5'd[ATGCCATAGCATTTTTATCC]3' (20-mer)

pBAD Reverse

5'd[GATTTAATCTGTATCAGG]3' (18-mer)

pFastBac Forward

5'd[GGATTATTCATACCGTCCCA]3' (22-mer)

pFastBac Reverse

5'd[CAAATGTGGTATGGCTGATT]3' (22-mer)

pGEX 3'

5'd[GAGCTGCATGTGTCAGAGG]3' (18-mer)

pGEX 5'

5'd[GGCAAGCCACGTTTGGTG]3' (18-mer)
 

Home
|
About Us
|
Registration
|
My Account
|
Contact Us
Phone: US Toll Free (877) 369-5430 or (510) 334-9669    Fax: (510) 619-9534    Email: info@tacgen.com
Copyright 2007-2014 TACGen
Untitled Document